-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 18726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 18726-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 18726-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC18+Thy1 promoter
- Backbone size w/o insert (bp) 9188
-
Vector typeMammalian Expression, Mouse Targeting, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKusabira ; M-mCherry ; M-mEYFP ; M-mCerulean
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI / XhoI (destroyed during cloning)
- 3′ cloning site SspI / XhoI (destroyed during cloning)
- 5′ sequencing primer Thy1 F1 primer (TCTGAGTGGCAAAGGACCTTAGG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Author's Map is a representative Brainbow 1.1 construct (M= membrane tethered).
Thy1 promoter. To linearize plasmid and remove vector sequences, EcoRI + PvuI , or alternatively NotI + PvuI are used (Note that PvuI also cuts inside the pUC18 vector).
Please see attached PDF for important additional information.
DNA (Catalog # 18726-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 18726-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Thy1-Brainbow-1.1 M was a gift from Joshua Sanes (Addgene plasmid # 18726 ; http://n2t.net/addgene:18726 ; RRID:Addgene_18726) -
For your References section:
Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Livet J, Weissman TA, Kang H, Draft RW, Lu J, Bennis RA, Sanes JR, Lichtman JW. Nature. 2007 Nov 1. 450(7166):56-62. 10.1038/nature06293 PubMed 17972876