pHRSin_hTCRβεζ
(Plasmid
#187353)
-
PurposeLentiviral expression of GPa3b17 hTCR beta, and truncated hCD3 (epsilon, and zeta)
-
Depositing Lab
-
Depositing OrganizationUniversity of Oxford
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHRSin
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsTop10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPa3b17 hTCR beta, and truncated hCD3 (epsilon, and zeta)
-
SpeciesH. sapiens (human)
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGCTTCTCGCTTCTGTTCG
- 3′ sequencing primer CCACATAGCGTAAAAGGAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHRSin_hTCRβεζ was a gift from Simon Davis (Addgene plasmid # 187353 ; http://n2t.net/addgene:187353 ; RRID:Addgene_187353) -
For your References section:
Structure of a fully assembled tumor-specific T cell receptor ligated by pMHC. Susac L, Vuong MT, Thomas C, von Bulow S, O'Brien-Ball C, Santos AM, Fernandes RA, Hummer G, Tampe R, Davis SJ. Cell. 2022 Aug 18;185(17):3201-3213.e19. doi: 10.1016/j.cell.2022.07.010. 10.1016/j.cell.2022.07.010 PubMed 35985289