mcherry p62 delta UBA silent
(Plasmid
#187984)
-
Purposemcherry p62 lacking UBA domain (aa389-434) but it has the silent mutations to be resistant to sip62. Internal reference: SMC572
-
Depositing Lab
-
Depositing OrganizationUniversity of Vienna
Located in Austria -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepmCherry-C1 Vector
-
Backbone manufacturerClontech #632524
- Backbone size w/o insert (bp) 4722
- Total vector size (bp) 5707
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namep62
-
SpeciesH. sapiens (human)
-
MutationLacking UBA domain (aa389-434) but it has the silent mutations to be resistant to sip62 #5
-
GenBank ID23636 NM_153719
-
Entrez GeneNUP62 (a.k.a. IBSN, SNDI, p62)
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAATGGCGTCGCTCACCGTGAAGGCCT
- 3′ sequencing primer ggTCACAACGGCGGGGGATGCTTTGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mcherry p62 delta UBA silent was a gift from Sascha Martens (Addgene plasmid # 187984 ; http://n2t.net/addgene:187984 ; RRID:Addgene_187984) -
For your References section:
Oligomerization of p62 allows for selection of ubiquitinated cargo and isolation membrane during selective autophagy. Wurzer B, Zaffagnini G, Fracchiolla D, Turco E, Abert C, Romanov J, Martens S. Elife. 2015 Sep 28;4:e08941. doi: 10.7554/eLife.08941. 10.7554/eLife.08941 PubMed 26413874