p426-Cup1p-FUS-FusionRed
(Plasmid
#188393)
-
PurposeCu2+-dependent expression of N-terminal FUS fused with red fluorescent protein in yeast cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbone426Gal-FUS-YFP (addgene #29592)
-
Backbone manufacturerAaron Gitler
- Backbone size w/o insert (bp) 6185
- Total vector size (bp) 8522
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFUS
-
Alt nameN-terminal region of human fused in sarcoma (FUS)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2337
-
Entrez GeneFUS (a.k.a. ALS6, ETM4, FUS1, HNRNPP2, POMP75, TLS, altFUS)
- Promoter CUP1 promoter
-
Tag
/ Fusion Protein
- FusionRed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer CAGGAAACAGCTATGAC
- 3′ sequencing primer GACCTAGACTTCAGGTTGTCTAACTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFUS-FusionRed-PixD was a gift from Jared Toettcher (Addgene plasmid # 111503 ; http://n2t.net/addgene:111503 ; RRID:Addgene_111503)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p426-Cup1p-FUS-FusionRed was a gift from Michihiko Kataoka (Addgene plasmid # 188393 ; http://n2t.net/addgene:188393 ; RRID:Addgene_188393) -
For your References section:
Foci-forming regions of pyruvate kinase and enolase at the molecular surface incorporate proteins into yeast cytoplasmic metabolic enzymes transiently assembling (META) bodies. Utsumi R, Murata Y, Ito-Harashima S, Akai M, Miura N, Kuroda K, Ueda M, Kataoka M. PLoS One. 2023 Apr 13;18(4):e0283002. doi: 10.1371/journal.pone.0283002. eCollection 2023. 10.1371/journal.pone.0283002 PubMed 37053166