K365-micro
(Plasmid
#188457)
-
PurposeComponent of optically-induced motor dimerization system
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Santa Barbara
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepQE-80L
-
Backbone manufacturerQiagen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKinesin 1-365
-
Alt nameKinesin heavy chain
-
Alt nameHis MBP K365 SspB micro
-
SpeciesD. melanogaster (fly)
-
MutationKinesin amino acids 1-365
-
Entrez GeneKhc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis-MBP-TEV (N terminal on insert)
- SspB micro (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAACGCCCGACTAAAGGGTAAGggtagtggtagtggatccagctccccgaaacgc
- 3′ sequencing primer CTTACCCTTTAGTCGGGCGTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid was derived from plasmids made by Jeff Gelles, Brian Kulman and Matt Thomson. This plasmid was created with Tyler Ross and Matt Thomson.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K365-micro was a gift from Zvonimir Dogic (Addgene plasmid # 188457 ; http://n2t.net/addgene:188457 ; RRID:Addgene_188457) -
For your References section:
Spatio-temporal patterning of extensile active stresses in microtubule-based active fluids. Lemma LM, Varghese M, Ross TD, Thomson M, Baskaran A, Dogic Z. PNAS Nexus. 2023 Apr 12;2(5):pgad130. doi: 10.1093/pnasnexus/pgad130. eCollection 2023 May. 10.1093/pnasnexus/pgad130 PubMed 37168671