pIN1 (gpdA-cTerm-mGL-ptrA)
(Plasmid
#188735)
-
PurposeExpresses mGreenlantern for C-terminal tagging
-
Depositing Lab
-
Depositing OrganizationUniversity of Manchester
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 188735-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 188735-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2395
- Total vector size (bp) 6484
-
Vector typeFilamentous Fungal expression
-
Selectable markersPyrithiamine
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegdpA-mGreenlantern PtrA
-
SpeciesAspergillus fumigatus
-
Insert Size (bp)4100
- Promoter gpdA
-
Tag
/ Fusion Protein
- mGreenlantern (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agcgagtcagtgagcgag
- 3′ sequencing primer tacaatctgctctgatgccg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 188735-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 188735-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIN1 (gpdA-cTerm-mGL-ptrA) was a gift from Michael Bromley (Addgene plasmid # 188735 ; http://n2t.net/addgene:188735 ; RRID:Addgene_188735) -
For your References section:
Shining a light on the impact of antifungals on Aspergillus fumigatus subcellular dynamics through fluorescence imaging. Storer ISR, Sastre-Velasquez LE, Easter T, Mertens B, Dallemulle A, Bottery M, Tank R, Offterdinger M, Bromley MJ, van Rhijn N, Gsaller F. Antimicrob Agents Chemother. 2024 Nov 6;68(11):e0080324. doi: 10.1128/aac.00803-24. Epub 2024 Oct 15. 10.1128/aac.00803-24 PubMed 39404344