SpCas9 dFE
(Plasmid
#190137)
-
PurposeExpresses SpCas9-T4pol (dFE)
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 190137-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 190137-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330A
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9-T4pol (dFE)
-
SpeciesSynthetic
-
Insert Size (bp)7029
-
MutationCodon Optimized for mammalian cells
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
- 3′ sequencing primer T3 (GCAATTAACCCTCACTAAAGG)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTakashi Yamamoto
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Supplemental GenBank file: pX330A-1x2 (Plasmid #58766) . Please visit https://doi.org/10.1101/2022.12.05.518807 for bioRxiv preprint.
DNA (Catalog # 190137-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 190137-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SpCas9 dFE was a gift from Timothy Lu (Addgene plasmid # 190137 ; http://n2t.net/addgene:190137 ; RRID:Addgene_190137) -
For your References section:
Frame Editors for Precise, Template-Free Frameshifting. Nakade S, Nakamae K, Tang T-C, Yu D, Sakuma T, Yamamoto T, Lu TK. bioRxiv 2022.12.05.518807 10.1101/2022.12.05.518807