pPN-mKate (PT7LacO-PN-mKate)
(Plasmid
#191126)
-
PurposeExpression of protein N tagged with mKate from a T7-lac inducible promoter
-
Depositing Lab
-
Depositing OrganizationINSERM U1284, Center for Research and Interdisciplinarity (CRI)
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 191126-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 191126-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepT7-LacO
- Backbone size w/o insert (bp) 4145
- Total vector size (bp) 4466
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameProtein N
-
Alt nameλN
-
Alt namePN
-
SpeciesSynthetic
-
Insert Size (bp)321
- Promoter T7-lac inducible promoter
-
Tag
/ Fusion Protein
- mKate
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atggtgtccgggatctcgac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 191126-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 191126-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPN-mKate (PT7LacO-PN-mKate) was a gift from Ariel Lindner (Addgene plasmid # 191126 ; http://n2t.net/addgene:191126 ; RRID:Addgene_191126) -
For your References section:
Spatial engineering of E. coli with addressable phase-separated RNAs. Guo H, Ryan JC, Song X, Mallet A, Zhang M, Pabst V, Decrulle AL, Ejsmont P, Wintermute EH, Lindner AB. Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016. 10.1016/j.cell.2022.09.016 PubMed 36179672
Map uploaded by the depositor.
