Skip to main content

LacZ_pHIVEGFP
(Plasmid #191251)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191251 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pHIV-EGFP
  • Backbone manufacturer
    addgene Plasmid #21373
  • Backbone size w/o insert (bp) 6900
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LacZ
  • GenBank ID
    945006
  • Promoter EF1alpha
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGAATTTGCCCTTTTTGAG
  • 3′ sequencing primer AGGAACTGCTTCCTTCACGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LacZ_pHIVEGFP was a gift from Chen Davidovich (Addgene plasmid # 191251 ; http://n2t.net/addgene:191251 ; RRID:Addgene_191251)
  • For your References section:

    PALI1 facilitates DNA and nucleosome binding by PRC2 and triggers an allosteric activation of catalysis. Zhang Q, Agius SC, Flanigan SF, Uckelmann M, Levina V, Owen BM, Davidovich C. Nat Commun. 2021 Jul 28;12(1):4592. doi: 10.1038/s41467-021-24866-3. 10.1038/s41467-021-24866-3 PubMed 34321472