Skip to main content

pIRES2_hMela(CT+IL3 mGluR6)
(Plasmid #191343)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191343 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pIRES2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 5277
  • Total vector size (bp) 6666
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hMela(CT+IL3 mGluR6)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1389
  • GenBank ID
    MQ072299.1
  • Entrez Gene
    LCOR (a.k.a. C10orf12, MLR2)
  • Tag / Fusion Protein
    • IRES_Turbo

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer atgaaccctccttcggggccaag
  • 3′ sequencing primer cCCAGCACCTGCCCTGCCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRES2_hMela(CT+IL3 mGluR6) was a gift from Sonja Kleinlogel (Addgene plasmid # 191343 ; http://n2t.net/addgene:191343 ; RRID:Addgene_191343)
  • For your References section:

    Bipolar cell targeted optogenetic gene therapy restores parallel retinal signaling and high-level vision in the degenerated retina. Kralik J, van Wyk M, Stocker N, Kleinlogel S. Commun Biol. 2022 Oct 20;5(1):1116. doi: 10.1038/s42003-022-04016-1. 10.1038/s42003-022-04016-1 PubMed 36266533