pUS252s
(Plasmid
#191833)
-
PurposeExpresses fuGFPs constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFPs to place in other plasmid backbones
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 191833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepK18
- Backbone size w/o insert (bp) 2633
- Total vector size (bp) 3356
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefuGFPs
-
SpeciesSynthetic
-
Insert Size (bp)726
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI, EcoRI, XbaI, XhoI (unknown if destroyed)
- 3′ cloning site HindIII, PstI, SphI (unknown if destroyed)
- 5′ sequencing primer CTTCCGGCTCGTATGTTGTG
- 3′ sequencing primer GCAAGGCGATTAAGTTGGGTAACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
fuGFPs is an open-source superfolding green fluorescent protein with excitation maximum at 397 nm and emission maximum at 510 nm. Relative to the original fuGFP, the protein contains the T203I mutation ('Sapphire'), which reduces its absorption of blue light (amino acid numbering based on classical GFP).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUS252s was a gift from Nicholas Coleman & Mark Somerville (Addgene plasmid # 191833 ; http://n2t.net/addgene:191833 ; RRID:Addgene_191833)