Skip to main content

pCRISPR3_BC5
(Plasmid #191860)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191860 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCRISPR3
  • Backbone size (bp) 2354
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer CTTCACCTCGAGAGGTTTGACAG
  • 3′ sequencing primer CCATTATTAGTACAGCGAGGCAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2022.08.19.504444v1 bioRxiv preprint.

This E. coli plasmid is an empty vector used to express CRISPRi sgRNAs and constitutively expresses a selectable KanR gene. It contains a 6-nucleotide barcode (sequence: AGTCTA) near the sgRNA insert region. This can be used to sequence an sgRNA array and the plasmid barcode in a single NGS read, thus assigning a paired sgRNA identity and plasmid backbone identity.

This internal barcoding strategy enables a single, mixed CRISPRi experiment to contain biological replicates, identified using distinct plasmid barcodes. It also contains orthogonal priming sites specific to the pCRISPR3 plasmid backbone, which can be used to specifically amplify pCRISPR3 plasmids from a mixed plasmid pool (generated during the cloning methods described in the publications below).

See the following publications for details and cloning information:

Mathis et al., A simplified strategy for titrating gene expression reveals new relationships between genotype, environment, and bacterial growth. https://pubmed.ncbi.nlm.nih.gov/33221881/

Otto et al., A continuous epistasis model for predicting growth rate given combinatorial variation in gene expression and environment.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR3_BC5 was a gift from Kimberly Reynolds (Addgene plasmid # 191860 ; http://n2t.net/addgene:191860 ; RRID:Addgene_191860)
  • For your References section:

    A continuous epistasis model for predicting growth rate given combinatorial variation in gene expression and environment. Otto RM, Turska-Nowak A, Brown PM, Reynolds KA. Cell Syst. 2024 Feb 21;15(2):134-148.e7. doi: 10.1016/j.cels.2024.01.003. Epub 2024 Feb 9. 10.1016/j.cels.2024.01.003 PubMed 38340730