pET-15b(ETNPPL)
(Plasmid
#192264)
-
PurposeCoding sequence of mouse ETNPPL is inserted in pET-15b vector
-
Depositing Lab
-
Depositing OrganizationThe University of Osaka
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET-15b
-
Backbone manufacturerMillipore
- Backbone size w/o insert (bp) 5710
- Total vector size (bp) 7210
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameethanolamine phosphate phospholyase
-
Alt nameEtnppl
-
Alt nameAgxt2l1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1500
-
GenBank IDNM_027907.3
-
Entrez GeneEtnppl (a.k.a. 1300019H02Rik, Agxt2l1)
-
Tag
/ Fusion Protein
- His-tag (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taagcatggtcaagggtgat
- 3′ sequencing primer gccatggactccaagagtgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-15b(ETNPPL) was a gift from Toshihide Yamashita (Addgene plasmid # 192264 ; http://n2t.net/addgene:192264 ; RRID:Addgene_192264) -
For your References section:
Utilization of ethanolamine phosphate phospholyase as a unique astrocytic marker. Tsujioka H, Yamashita T. Front Cell Neurosci. 2023 Jan 30;17:1097512. doi: 10.3389/fncel.2023.1097512. eCollection 2023. 10.3389/fncel.2023.1097512 PubMed 36794261