pBS-TRE-mTagBFP2-WPRE
(Plasmid
#193332)
-
PurposeExpresses mTagBFP2 under the TRE promoter in mammalian cells
-
Depositing Lab
-
Depositing OrganizationKyushu University
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 193332-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 193332-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBluescript SK(+)
-
Backbone manufacturerStratagene
- Total vector size (bp) 4747
-
Modifications to backboneAn Xho-Xho fragment containing TRE-SV40 poly A was transferred from pTRE-Tight (Clontech). WPRE was also inserted between a NotI site (not destroyed)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTagBFP2
-
SpeciesModified fluorescent protein
-
Insert Size (bp)714
-
MutationA XhoI site in the coding sequence is silenced
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATGTCGAGGTAGGCGTGTAC
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTagBFP gene was purchased from Evrogen
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.20.512984v1 for bioRxiv preprint.
DNA (Catalog # 193332-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 193332-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS-TRE-mTagBFP2-WPRE was a gift from Takeshi Imai (Addgene plasmid # 193332 ; http://n2t.net/addgene:193332 ; RRID:Addgene_193332) -
For your References section:
Automated neuronal reconstruction with super-multicolour Tetbow labelling and threshold-based clustering of colour hues. Leiwe MN, Fujimoto S, Baba T, Moriyasu D, Saha B, Sakaguchi R, Inagaki S, Imai T. Nat Commun. 2024 Jun 25;15(1):5279. doi: 10.1038/s41467-024-49455-y. 10.1038/s41467-024-49455-y PubMed 38918382