Skip to main content

pLV-mCherry-hCdt1(1-100)ΔCy
(Plasmid #193759)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 193759 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLV-EF1a
  • Backbone size w/o insert (bp) 7482
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-hCdt1(1-100)ΔCy
  • Alt name
    N-CRL4Cdt2 reporter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1050
  • Mutation
    human Cdt1 amino acids 1-100 w/ ΔCy mutation (aa68-70 to alanine)
  • Entrez Gene
    CDT1 (a.k.a. DUP, RIS2)
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcaagcctcagacagtggttc
  • 3′ sequencing primer cattaaagcagcgtatcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 3rd generation packaging system (pMDLg/pRRE, pRSV-rev, and pVSVG) was used to create virus from this lentiviral transfer vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-mCherry-hCdt1(1-100)ΔCy was a gift from Tobias Meyer (Addgene plasmid # 193759 ; http://n2t.net/addgene:193759 ; RRID:Addgene_193759)
  • For your References section:

    CDT1 inhibits CMG helicase in early S phase to separate origin licensing from DNA synthesis. Ratnayeke N, Baris Y, Chung M, Yeeles JTP, Meyer T. Mol Cell. 2023 Jan 5;83(1):26-42.e13. doi: 10.1016/j.molcel.2022.12.004. 10.1016/j.molcel.2022.12.004 PubMed 36608667