pCW-ND-Cdt1ΔR198A/R210A-HA-Puro
(Plasmid
#193769)
-
PurposeDoxycyline-inducible (TetOn) human Cdt1 (SV40 NLS , C-terminal HA ) w/ mutations stopping S phase degradation and in MCM binding (R198A/R210A), expressed from all-in-one pCW vector (TetOn + rtTA)
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCW
- Backbone size w/o insert (bp) 7606
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameND-Cdt1ΔR198A/R210A
-
Alt nameNon-degradable Cdt1ΔR198A/R210A-HA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1689
-
Mutationamino acids 1-19 deleted, ΔCy mutation (aa68-70 to alanine), R198A, R210A, SV40 NLS, 1-183 bp codon optimized
-
Entrez GeneCDT1 (a.k.a. DUP, RIS2)
- Promoter TRE
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagagctcgtttagtgaaccg
- 3′ sequencing primer cggaaccacgcccagagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 3rd generation packaging system (pMDLg/pRRE, pRSV-rev, and pVSVG) was used to create virus from this lentiviral transfer vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-ND-Cdt1ΔR198A/R210A-HA-Puro was a gift from Tobias Meyer (Addgene plasmid # 193769 ; http://n2t.net/addgene:193769 ; RRID:Addgene_193769) -
For your References section:
CDT1 inhibits CMG helicase in early S phase to separate origin licensing from DNA synthesis. Ratnayeke N, Baris Y, Chung M, Yeeles JTP, Meyer T. Mol Cell. 2023 Jan 5;83(1):26-42.e13. doi: 10.1016/j.molcel.2022.12.004. 10.1016/j.molcel.2022.12.004 PubMed 36608667