Skip to main content
Addgene
Open Menu

pCB19
(Plasmid #194757)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194757 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 194757-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 194757-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pGE-attB-GMR
  • Backbone manufacturer
    Huang et al., 2009, PMID 19429710
  • Backbone size w/o insert (bp) 6160
  • Vector type
    phiC31-integration vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GluRIIA
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    4969
  • Mutation
    none
  • Entrez Gene
    GluRIIA (a.k.a. Dmel_CG6992, CG6992, D-GluRIIA, DGluR-II, DGluR-IIA, DGluR2a, DGluRIIA, DGluRIIa, DgluRII, DmelGluRIIA, Dmel\CG6992, Glu-RII, Glu-RIIA, GluR, GluR-IIA, GluR2, GluR2a, GluRII, GluRII-A, GluRIIa, GluR[[IIa]], GlurIIA, dGluRII, dGluRIIA, dglur-IIA, dglurIIA, gluIIA, gluRIIA, glurIIA, gluriia)
  • Tag / Fusion Protein
    • EGFP-Tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ggtcccgtcggcaagagaca
  • 3′ sequencing primer GCGCATTTGGGTATATTGAATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB19 was a gift from Sven Dannhäuser (Addgene plasmid # 194757 ; http://n2t.net/addgene:194757 ; RRID:Addgene_194757)

  • For your References section:

    Versatile Endogenous Editing of GluRIIA in Drosophila melanogaster. Beckers CJ, Mrestani A, Komma F, Dannhauser S. Cells. 2024 Feb 10;13(4):323. doi: 10.3390/cells13040323. 10.3390/cells13040323 PubMed 38391936
Related items:
Commonly requested with: