pCDNA3.1_B1ChR2_TS_mScarlet_ER
(Plasmid
#195191)
-
PurposeHighly K+ selective channelrhodopsin
-
Depositing Labs
-
Depositing OrganizationHumboldt-Universitaet zu Berlin
Located in Germany -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDNA3.1
- Backbone size w/o insert (bp) 5340
- Total vector size (bp) 7336
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBilabrum sp. K+ selective channelrhodopsin 2
-
Alt nameB1ChR2
-
SpeciesSynthetic; Bilabrum sp
-
Insert Size (bp)1173
-
GenBank IDOP710242.1 UZU83955.1
- Promoter CMV
-
Tags
/ Fusion Proteins
- Kir2.1 trafficking motif (C terminal on insert)
- mscarlet (C terminal on insert)
- ER-export sequence (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer AGCCTCGACTGTGCCTTCTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3.1_B1ChR2_TS_mScarlet_ER was a gift from Peter Hegemann & Johannes Vierock (Addgene plasmid # 195191 ; http://n2t.net/addgene:195191 ; RRID:Addgene_195191) -
For your References section:
WiChR, a highly potassium selective channelrhodopsin for low-light one- and two-photon inhibition of excitable cells. Vierock J, Peter E, Grimm C, Rozenberg A, Chen IW, Tillert L, Castro Scalise AG, Casini M, Augustin S, Tanese D, Forget BC, Peyronnet R, Schneider-Warme F, Emiliani V, Beja O, Hegemann P. Sci Adv. 2022 Nov 16:eadd7729. 10.1126/sciadv.add7729 PubMed 36383037