pCAG-ASAP3ER
(Plasmid #195356)

• Purpose: ASAP3ER under the control of the pCAG promoter
• Depositing Lab: Brenda Bloodgood
• Publication: Campbell et al Cell Rep. 2023 Jan 31;42(1):111943. doi: 10.1016/j.celrep.2022.111943. Epub 2023 Jan 5.

Backbone

• Vector backbone: pCAGGs
• Backbone size w/o insert (bp): 6102
• Total vector size (bp): 7395
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ASAP3ER
• Insert Size (bp): 1293
• Promoter: pCAG
• Tag / Fusion Protein:
  • GFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: caggtgcaggctgcctatc
• 3′ sequencing primer: gcacagtcgaggctgatcagc

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry