Skip to main content

Pb459-mU6-sgRNA-EF1a-PuroR
(Plasmid #195507)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195507 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 195507-D50 50 μg of DNA in Tris buffer $495
DNA 195507-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    piggyBac
  • Vector type
    Mammalian Expression, CRISPR ; piggyBac
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Puromycin
  • gRNA/shRNA sequence
    GCCGACTAGGGTCGATA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer attctccttggaatttgccc
  • 3′ sequencing primer cccgacgatatgatcctgat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pb459-mU6-sgRNA-EF1a-PuroR was a gift from Joanna Wysocka (Addgene plasmid # 195507 ; http://n2t.net/addgene:195507 ; RRID:Addgene_195507)
  • For your References section:

    A genome-wide genetic screen uncovers determinants of human pigmentation. Bajpai VK, Swigut T, Mohammed J, Naqvi S, Arreola M, Tycko J, Kim TC, Pritchard JK, Bassik MC, Wysocka J. Science. 2023 Aug 11;381(6658):eade6289. doi: 10.1126/science.ade6289. Epub 2023 Aug 11. 10.1126/science.ade6289 PubMed 37561850