Skip to main content

pUGP1.1
(Plasmid #196615)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196615 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pG23A, originally HO-poly-KanMX4-HO
  • Backbone manufacturer
    https://www.ncbi.nlm.nih.gov/pmc/articles/PMC55758/
  • Backbone size w/o insert (bp) 2531
  • Total vector size (bp) 5881
  • Vector type
    Yeast Expression
  • Selectable markers
    NatMX (select with Nourseotrichin)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UGP1::mCherry-AID(71-114)-NatMX
  • Alt name
    YKL035W
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    3350
  • Entrez Gene
    UGP1 (a.k.a. YKL035W)
  • Promoter Native promoter
  • Tags / Fusion Proteins
    • mCherry (C terminal on insert)
    • AID(71-114) (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGTCAAGGAGGGTATTCTGG
  • 3′ sequencing primer CCTTGAAGCGCATGAACTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning details are provided in Supplementary Table 2 of the paper. Details of the parent plasmid pG23A can be found on Addgene (Plasmid #102884).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUGP1.1 was a gift from Matthias Heinemann (Addgene plasmid # 196615 ; http://n2t.net/addgene:196615 ; RRID:Addgene_196615)
  • For your References section:

    Temporal segregation of biosynthetic processes is responsible for metabolic oscillations during the budding yeast cell cycle. Takhaveev V, Ozsezen S, Smith EN, Zylstra A, Chaillet ML, Chen H, Papagiannakis A, Milias-Argeitis A, Heinemann M. Nat Metab. 2023 Feb;5(2):294-313. doi: 10.1038/s42255-023-00741-x. Epub 2023 Feb 27. 10.1038/s42255-023-00741-x PubMed 36849832