pminiT-MED6-Halo donor
(Plasmid
#197866)
-
PurposeDonor plasmid used for building MED6-Halo knock-in mESCs
-
Depositing Lab
-
Depositing OrganizationHHMI, Janelia Research Campus
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 197866-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 197866-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepminiT
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 2525
- Total vector size (bp) 4394
-
Vector typeMouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMed6
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001347384.1 NP_001334313.1
-
Entrez GeneMed6 (a.k.a. 1500012F11Rik)
- Promoter NA
-
Tag
/ Fusion Protein
- Halotag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATAAAGAGGAACGCAGAATG
- 3′ sequencing primer CACGGTGCTGAGGTATAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.26.513917v1 for bioRxiv preprint.
DNA (Catalog # 197866-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 197866-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pminiT-MED6-Halo donor was a gift from Zhe J. Liu (Addgene plasmid # 197866 ; http://n2t.net/addgene:197866 ; RRID:Addgene_197866) -
For your References section:
Spatial organization of the 3D genome encodes gene co-expression programs in single cells. Dong P, Zhang S, Xie L, Wang L, Lemire AL, Lander AD, Chang HY, Liu ZJ. bioRxiv 2022.10.26.513917 10.1101/2022.10.26.513917