Skip to main content

pminiT-MED6-Halo donor
(Plasmid #197866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197866 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pminiT
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 2525
  • Total vector size (bp) 4394
  • Vector type
    Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Med6
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001347384.1 NP_001334313.1
  • Entrez Gene
    Med6 (a.k.a. 1500012F11Rik)
  • Promoter NA
  • Tag / Fusion Protein
    • Halotag (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATAAAGAGGAACGCAGAATG
  • 3′ sequencing primer CACGGTGCTGAGGTATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pminiT-MED6-Halo donor was a gift from Zhe J. Liu (Addgene plasmid # 197866 ; http://n2t.net/addgene:197866 ; RRID:Addgene_197866)
  • For your References section:

    Spatial organization of the 3D genome encodes gene co-expression programs in single cells. Dong P, Zhang S, Xie L, Wang L, Lemire AL, Lander AD, Chang HY, Liu ZJ. bioRxiv 2022.10.26.513917 10.1101/2022.10.26.513917