psiCHECK SCN1B 3'UTR
(Plasmid
#19855)
-
Depositing Lab
-
Depositing OrganizationRockefeller University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 19855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 19855-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 19855-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepsiCHECK-2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6249
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSCN1B 3'UTR
-
Alt nameSCN1B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)606
-
GenBank IDNM_001037
-
Entrez GeneSCN1B (a.k.a. ATFB13, BRGDA5, DEE52, EIEE52, GEFSP1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTACATCAAGAGCTTCGTGG
- 3′ sequencing primer AAGACTCATTTAGATCCTCACAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.
DNA (Catalog # 19855-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 19855-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK SCN1B 3'UTR was a gift from Thomas Tuschl (Addgene plasmid # 19855 ; http://n2t.net/addgene:19855 ; RRID:Addgene_19855) -
For your References section:
Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. Landthaler M, Gaidatzis D, Rothballer A, Chen PY, Soll SJ, Dinic L, Ojo T, Hafner M, Zavolan M, Tuschl T. RNA. 2008 Dec;14(12):2580-96. doi: 10.1261/rna.1351608. Epub 2008 Oct 31. 10.1261/rna.1351608 PubMed 18978028