Skip to main content

psiCHECK TTLL11 3'UTR
(Plasmid #19857)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 19857 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 19857-D50 50 μg of DNA in Tris buffer $495
DNA 19857-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6249
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TTLL11 3'UTR
  • Alt name
    TTLL11
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    217
  • GenBank ID
    NM_194252
  • Entrez Gene
    TTLL11 (a.k.a. C9orf20, bA244O19.1, RP11-429D3.1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTACATCAAGAGCTTCGTGG
  • 3′ sequencing primer AAGACTCATTTAGATCCTCACAC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK TTLL11 3'UTR was a gift from Thomas Tuschl (Addgene plasmid # 19857 ; http://n2t.net/addgene:19857 ; RRID:Addgene_19857)
  • For your References section:

    Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. Landthaler M, Gaidatzis D, Rothballer A, Chen PY, Soll SJ, Dinic L, Ojo T, Hafner M, Zavolan M, Tuschl T. RNA. 2008 Dec;14(12):2580-96. doi: 10.1261/rna.1351608. Epub 2008 Oct 31. 10.1261/rna.1351608 PubMed 18978028