Skip to main content

AID∆C-Cas9n-UGI-NLS
(Plasmid #198890)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198890 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 198890-D50 50 μg of DNA in Tris buffer $495
DNA 198890-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    BE3
  • Backbone size w/o insert (bp) 9321
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Actication induced deaminase
  • Alt name
    AID
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    549
  • Mutation
    Deletion of amino acids 189-198
  • Entrez Gene
    AICDA (a.k.a. AID, ARP2, CDA2, HEL-S-284, HIGM2)
  • Promoter CMV
  • Tag / Fusion Protein
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer CAAAGAAGGAACCAGGTCCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Also expresses Cas9n-UGI-NLS

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AID∆C-Cas9n-UGI-NLS was a gift from Reuben Harris (Addgene plasmid # 198890 ; http://n2t.net/addgene:198890 ; RRID:Addgene_198890)
  • For your References section:

    APOBEC Reporter Systems for Evaluating diNucleotide Editing Levels. Rieffer AE, Chen Y, Salamango DJ, Moraes SN, Harris RS. CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6. 10.1089/crispr.2023.0027 PubMed 37672599