Skip to main content

LPUtopia-7
(Plasmid #199212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199212 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 199212-D50 50 μg of DNA in Tris buffer $495
DNA 199212-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    DC-RFP-SH01
  • Backbone manufacturer
    GeneCopoeia
  • Backbone size w/o insert (bp) 5630
  • Total vector size (bp) 9429
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    aminoglycoside phosphotransferase,
  • Alt name
    NeoR/KanR
  • Species
    Synthetic
  • Insert Size (bp)
    804
  • Promoter thymidine kinase promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer TCCACCCCACAGTGGGGC
  • 3′ sequencing primer gagcagattgtactgagagtcgacgg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    enhanced Green Fluorescence Protein
  • Alt name
    GFP
  • Species
    Synthetic
  • Insert Size (bp)
    719
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer GACATTGATTATTGACTAGTTATTAA
  • 3′ sequencing primer ctctcgttaattaactcgag
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Red Fluorescence Protein
  • Alt name
    RFP
  • Species
    Synthetic
  • Insert Size (bp)
    699
  • Promoter CMV

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gggggactttcctacttggc
  • 3′ sequencing primer cagcaacgcggcctttttac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LPUtopia-7 was a gift from Gabor Balazsi (Addgene plasmid # 199212 ; http://n2t.net/addgene:199212 ; RRID:Addgene_199212)
  • For your References section:

    Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268