Skip to main content
Addgene
Open Menu

pCAG1.1-Myc/TSSK1
(Plasmid #199624)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199624 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 199624-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 199624-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAG1.1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tssk1 mRNA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1098
  • Entrez Gene
    Tssk1 (a.k.a. Stk22a, TSK-1, Tsk1, Tssk, Tssk1b)
  • Promoter CAG
  • Tag / Fusion Protein
    • Myc-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTTCGGCTTCTGGCGTGTGA
  • 3′ sequencing primer ATAAATTTCCTTTATTAGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG1.1-Myc/TSSK1 was a gift from Masahito Ikawa (Addgene plasmid # 199624 ; http://n2t.net/addgene:199624 ; RRID:Addgene_199624)

  • For your References section:

    TSKS localizes to nuage in spermatids and regulates cytoplasmic elimination during spermiation. Shimada K, Park S, Oura S, Noda T, Morohoshi A, Matzuk MM, Ikawa M. Proc Natl Acad Sci U S A. 2023 Mar 14;120(11):e2221762120. doi: 10.1073/pnas.2221762120. Epub 2023 Mar 7. 10.1073/pnas.2221762120 PubMed 36881620
Related items:
Commonly requested with: