Skip to main content

AAV_pSyn_Mito-LOV-Turbo-V5
(Plasmid #199669)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199669 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 3695
  • Total vector size (bp) 5189
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LOV-Turbo
  • Alt name
    Light regulated TurboID
  • Species
    Synthetic
  • Insert Size (bp)
    1362
  • Promoter Synapsin
  • Tags / Fusion Proteins
    • COX4I1 mito targeting sequence (N terminal on insert)
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gactcagcgctgcctcagtc
  • 3′ sequencing primer GGCTGATCAGCGAGCTCTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_pSyn_Mito-LOV-Turbo-V5 was a gift from Alice Ting (Addgene plasmid # 199669 ; http://n2t.net/addgene:199669 ; RRID:Addgene_199669)
  • For your References section:

    Engineered allostery in light-regulated LOV-Turbo enables precise spatiotemporal control of proximity labeling in living cells. Lee SY, Cheah JS, Zhao B, Xu C, Roh H, Kim CK, Cho KF, Udeshi ND, Carr SA, Ting AY. Nat Methods. 2023 May 15. doi: 10.1038/s41592-023-01880-5. 10.1038/s41592-023-01880-5 PubMed 37188954