PB-TAC-ERP2-(N-HA)KRAS_G12D
(Plasmid
#201254)
-
PurposeDox-inducible overexpression of HA-tagged KRASG12D and mCherry in human cells
-
Depositing Lab
-
Depositing OrganizationUniversitaetsklinikum Ulm
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 201254-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 201254-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePB-TAC-ERP2
-
Backbone manufacturerKnut Woltjen, Addgene plasmid #80478
- Backbone size w/o insert (bp) 10723
- Total vector size (bp) 11347
-
Modifications to backboneNone
-
Vector typeMammalian Expression ; piggyBac transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAS
-
Alt nameKirsten rat sarcoma viral oncogene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)624
-
Mutationchanged Gly (G) 12 to Asp (D)
-
GenBank IDNM_001369787.1 NM_004985.5
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RALD2, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter TRE
-
Tag
/ Fusion Protein
- HA-Tag (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer aaaaagcaggcttcactagtgtctttcataagcttatgtatccatatgatgtgcccgact
- 3′ sequencing primer agaaagctgggtgtgacacacattccacagggt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypBABE-KRAS G12D, Addgene 58902, Channing Der lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 201254-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 201254-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TAC-ERP2-(N-HA)KRAS_G12D was a gift from Alexander Kleger (Addgene plasmid # 201254 ; http://n2t.net/addgene:201254 ; RRID:Addgene_201254) -
For your References section:
Modeling plasticity and dysplasia of pancreatic ductal organoids derived from human pluripotent stem cells. Breunig M, Merkle J, Wagner M, Melzer MK, Barth TFE, Engleitner T, Krumm J, Wiedenmann S, Cohrs CM, Perkhofer L, Jain G, Kruger J, Hermann PC, Schmid M, Madacsy T, Varga A, Griger J, Azoitei N, Muller M, Wessely O, Robey PG, Heller S, Dantes Z, Reichert M, Gunes C, Bolenz C, Kuhn F, Maleth J, Speier S, Liebau S, Sipos B, Kuster B, Seufferlein T, Rad R, Meier M, Hohwieler M, Kleger A. Cell Stem Cell. 2021 Jun 3;28(6):1105-1124.e19. doi: 10.1016/j.stem.2021.03.005. Epub 2021 Apr 28. 10.1016/j.stem.2021.03.005 PubMed 33915078
Map uploaded by the depositor.
