Dcp1
(Plasmid
#201410)
-
PurposeBacterial protein expression of Dcp1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneMTTH
- Backbone size w/o insert (bp) 6700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDcp1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)693
-
Entrez GeneDCP1 (a.k.a. YOL149W, MRT2)
- Promoter tac
-
Tags
/ Fusion Proteins
- MBP, TEV (N terminal on backbone)
- TEV, 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer CAGGAAACAGCTATGACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygene insert was a gift from Roy Parker (University of Colorado Boulder)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dcp1 was a gift from Michael Rosen (Addgene plasmid # 201410 ; http://n2t.net/addgene:201410 ; RRID:Addgene_201410) -
For your References section:
Quantitative reconstitution of yeast RNA processing bodies. Currie SL, Xing W, Muhlrad D, Decker CJ, Parker R, Rosen MK. Proc Natl Acad Sci U S A. 2023 Apr 4;120(14):e2214064120. doi: 10.1073/pnas.2214064120. Epub 2023 Mar 27. 10.1073/pnas.2214064120 PubMed 36972455