PX458-3xHA-en31FnCas9ABEmax8.17d
(Plasmid
#201956)
-
PurposeMammalian expression plasmid of en31FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNA
-
Depositing Lab
-
Depositing OrganizationInstitute of Genomics and Integrative Biology (CSIR-IGIB)
Located in India -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 201956-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 201956-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePX458
- Backbone size w/o insert (bp) 4234
- Total vector size (bp) 11308
-
Modifications to backboneA to G change on 8324 position to destroy EcoRI site
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebpNLS-en31FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)7074
- Promoter Cbh
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- 3xHA (C terminal on insert)
- T2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTCCGGGCTGTAATTAGCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 201956-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 201956-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX458-3xHA-en31FnCas9ABEmax8.17d was a gift from Debojyoti Chakraborty (Addgene plasmid # 201956 ; http://n2t.net/addgene:201956 ; RRID:Addgene_201956) -
For your References section:
PAM-flexible Engineered FnCas9 variants for robust and ultra-precise genome editing and diagnostics. Acharya S, Ansari AH, Kumar Das P, Hirano S, Aich M, Rauthan R, Mahato S, Maddileti S, Sarkar S, Kumar M, Phutela R, Gulati S, Rahman A, Goel A, Afzal C, Paul D, Agrawal T, Pulimamidi VK, Jalali S, Nishimasu H, Mariappan I, Nureki O, Maiti S, Chakraborty D. Nat Commun. 2024 Jun 28;15(1):5471. doi: 10.1038/s41467-024-49233-w. 10.1038/s41467-024-49233-w PubMed 38942756