Skip to main content

pBEL2108
(Plasmid #201969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201969 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 201969-D50 50 μg of DNA in Tris buffer $495
DNA 201969-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pKM468-EGFP
  • Vector type
    ORBIT integrating plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    attB-3C-eGFP-4xGly-TEV-Flag-6xHis
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGGAACTGGCGCAGTTCCTCTGG
  • 3′ sequencing primer CCTGGTATCTTTATAGTCCTGTCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kenan Murphy (source of pKM468-EGFP plasmid (Addgene plasmid # 108434))

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEL2108 was a gift from Gira Bhabha & Damian Ekiert (Addgene plasmid # 201969 ; http://n2t.net/addgene:201969 ; RRID:Addgene_201969)
  • For your References section:

    Structure of an endogenous mycobacterial MCE lipid transporter. Chen J, Fruhauf A, Fan C, Ponce J, Ueberheide B, Bhabha G, Ekiert D. Res Sq. 2023 Jan 10:rs.3.rs-2412186. doi: 10.21203/rs.3.rs-2412186/v1. Preprint. 10.21203/rs.3.rs-2412186/v1 PubMed 36711512