pBEL2108
(Plasmid #201969)

• Purpose: ORBIT integrating plasmid for C-terminal tagging with eGFP containing a 3C protease cleavage site.
• Depositing Labs: Gira Bhabha, Damian Ekiert
• Publication: Chen et al Res Sq. 2023 Jan 10:rs.3.rs-2412186. doi: 10.21203/rs.3.rs-2412186/v1. Preprint.

Backbone

• Vector backbone: pKM468-EGFP
• Vector type: ORBIT integrating plasmid

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: attB-3C-eGFP-4xGly-TEV-Flag-6xHis
• Species: Synthetic

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGAACTGGCGCAGTTCCTCTGG
• 3′ sequencing primer: CCTGGTATCTTTATAGTCCTGTCG

Resource Information

• Supplemental Documents:
  • pBEL2108.gb
• A portion of this plasmid was derived from a plasmid made by: Kenan Murphy (source of pKM468-EGFP plasmid (Addgene plasmid # 108434))

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.12.08.519548v2.full for bioRxiv preprint.