pCMV-MTS-FLAG-LOV*
(Plasmid
#202207)
-
PurposeExpresses the photoproximity labeling catalyst LOV* fused to the mitochondria targeting sequence (MTS) in mammalian cells
-
Depositing Lab
-
Depositing OrganizationPrinceton University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 202207-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 202207-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCytochrome c oxidase subunit 4 isoform 1, mitochondrial, aa 1-24
-
Alt nameMitochondria targeting sequence
-
SpeciesH. sapiens (human)
-
Insert Size (bp)432
- Promoter CMV
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- LOV* (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 202207-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 202207-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-MTS-FLAG-LOV* was a gift from Thomas Muir (Addgene plasmid # 202207 ; http://n2t.net/addgene:202207 ; RRID:Addgene_202207) -
For your References section:
A genetically encoded photoproximity labeling approach for mapping protein territories. Hananya N, Ye X, Koren S, Muir TW. Proc Natl Acad Sci U S A. 2023 Apr 18;120(16):e2219339120. doi: 10.1073/pnas.2219339120. Epub 2023 Apr 10. 10.1073/pnas.2219339120 PubMed 37036999