Skip to main content
Addgene
Open Menu

pDendra2-Hygro
(Plasmid #202407)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202407 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 202407-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 202407-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pDendra2-N Vector
  • Backbone manufacturer
    Clontech Laboratories, Inc.
  • Backbone size w/o insert (bp) 4705
  • Total vector size (bp) 5758
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Hygromycin
  • Insert Size (bp)
    1000
  • Promoter CMV
  • Tag / Fusion Protein
    • Dendra2 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer CACCAAAATCAACGGGACTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDendra2-Hygro was a gift from Morito Kurata (Addgene plasmid # 202407 ; http://n2t.net/addgene:202407 ; RRID:Addgene_202407)

  • For your References section:

    Indirect CRISPR screening with photoconversion revealed key factors of drug resistance with cell-cell interactions. Sugita K, Onishi I, Nakayama R, Ishibashi S, Ikeda M, Inoue M, Narita R, Oshima S, Shimizu K, Saito S, Sato S, Moriarity BS, Yamamoto K, Largaespada DA, Kitagawa M, Kurata M. Commun Biol. 2023 Jun 1;6(1):582. doi: 10.1038/s42003-023-04941-9. 10.1038/s42003-023-04941-9 PubMed 37264057
Related items: