pWR58
(Plasmid
#202795)
-
Purposeintegrating bioluminescene reporter for Cas9 activity in S. stipitis
-
Depositing Lab
-
Depositing OrganizationMiddle Tennessee State University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAllet
-
Backbone manufacturerRobertson
- Backbone size w/o insert (bp) 2216
- Total vector size (bp) 9734
-
Modifications to backbonepWR58 was constructed by first moving the PTEF1-ShBle-TACT1 insert from pWR10 into pAllet, then upstream of this adding an insert that contained a portion of pWR9 that included the TDH3 promoter and the first two thirds of the coCBG CDS plus the 20 nucleotide YUM1 Cas9 target sequence next to a PAM. Similarly downstream of the ShBle insert an insert was added that contained the 20 nucleotide YUM1 Cas9 target sequence next to a PAM followed by a portion of pWR9 that included the last two thirds of the coCBG CDS and ADH2 terminator. Finally, the URA3 integration element from pWR9 was excised and transferred to the plasmid.
-
Vector typeYeast Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameP-TDH3/coCBG(first portion)-YUM1
-
SpeciesSynthetic; S. stipitis (yeast)
-
Insert Size (bp)1854
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TCGTTAGTATTTCCGTGAAG
- 3′ sequencing primer CCAAATCAGTGAACCTTGTC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameP-TEF1/ShBle/T-ACT1
-
SpeciesSynthetic; S. stipitis (yeast)
-
Insert Size (bp)1513
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (destroyed during cloning)
- 5′ sequencing primer ATCTACCAGCGCTAACATTC
- 3′ sequencing primer TCTGCATGACTCCCTTTG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameYUM1-coCBG(last portion)/T-ADH2
-
SpeciesSynthetic; S. stipitis (yeast)
-
Insert Size (bp)1467
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGTGAAGTGTATAGAATTGTGC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameURA3 and flanking sequence
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)2754
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer CTCAGTACGAACAAGAGAATGA
- 3′ sequencing primer CACAGGGTTGATATTGTACG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycoCBG is a codon optimized version of Promega's CBG99 which was synthesized by GenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWR58 was a gift from J. Brian Robertson (Addgene plasmid # 202795 ; http://n2t.net/addgene:202795 ; RRID:Addgene_202795) -
For your References section:
BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937