CD-MPR-mCherry-RUSH
(Plasmid
#202798)
-
PurposeRUSH cargo: Str-KDEL_IRES_SBP-mCherry-CD-MPR
-
Depositing Lab
-
Depositing OrganizationNational Institute of Child Health and Human Development (NICHD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202798 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 202798-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 202798-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneOriginal RUSH construct (gift of F. Perezand G. Boncompain, Curie Institute; Boncompain et al., 2012, Nature Methods)
- Total vector size (bp) 6732
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameM6PR
-
Alt nameCD-MPR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)756
-
MutationChanged 40 K (AAA) with R (AGA)
-
GenBank IDNM_002355.4
-
Entrez GeneM6PR (a.k.a. CD-M6PR, CD-MPR, MPR 46, MPR-46, MPR46, SMPR)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 202798-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 202798-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CD-MPR-mCherry-RUSH was a gift from Juan Bonifacino (Addgene plasmid # 202798 ; http://n2t.net/addgene:202798 ; RRID:Addgene_202798) -
For your References section:
Segregation in the Golgi complex precedes export of endolysosomal proteins in distinct transport carriers. Chen Y, Gershlick DC, Park SY, Bonifacino JS. J Cell Biol. 2017 Dec 4;216(12):4141-4151. doi: 10.1083/jcb.201707172. Epub 2017 Oct 4. 10.1083/jcb.201707172 PubMed 28978644