pWR63
(Plasmid
#203331)
-
Purposeepisomal Cas9 and sgRNA expression vector without sgRNA for S. stipitis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepWR54
-
Backbone manufacturerRobertson
- Backbone size w/o insert (bp) 8299
- Total vector size (bp) 12119
-
Modifications to backboneCaCas9 from pV1093 (Vyas, Barrasa, Fink, 2015, Science advances. 1:e1500248) was added to pWR54 in place of coCBG. An sgRNA expression cassette was added that contained TDH3 promoter driving tRNA-sgRNA(SapI)-HDV element terminated by ADH1 terminator.
-
Vector typeYeast Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTEF1 promoter (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)726
-
Entrez GeneTEF1 (a.k.a. PICST_65303)
Gene/Insert 2
-
Gene/Insert namecoHPH
-
SpeciesSynthetic
-
Insert Size (bp)1029
Gene/Insert 3
-
Gene/Insert nameACT1 terminator (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)400
Gene/Insert 4
-
Gene/Insert nameCCW12 promoter (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)749
Gene/Insert 5
-
Gene/Insert nameCaCas9
-
SpeciesSynthetic
-
Insert Size (bp)1629
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site AflII (not destroyed)
- 5′ sequencing primer AACTGTCTGCCTTTGAGG
- 3′ sequencing primer GTCGTAATCAACATCCATATTC
- (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameADH2 terminator (S. stipitis)
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)374
Gene/Insert 7
-
Gene/Insert nameARS from S. stipitis chromosome 1
-
SpeciesS. stipitis (yeast)
-
Insert Size (bp)1148
Gene/Insert 8
-
Gene/Insert nameTHD3 promoter (S. stipitis)
-
SpeciesS. stipitis
-
Insert Size (bp)750
Cloning Information for Gene/Insert 8
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site FseI (not destroyed)
- 5′ sequencing primer TTCATTTACACAAGCTAGAACC
- (Common Sequencing Primers)
Gene/Insert 9
-
Gene/Insert nametRNA-sgRNA(SapI)-HDV
-
SpeciesSynthetic
-
Insert Size (bp)242
Cloning Information for Gene/Insert 9
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (destroyed during cloning)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer ctgcagccaatctgaaga
- 3′ sequencing primer CAGAGAAGAATGCATGCAC
- (Common Sequencing Primers)
Gene/Insert 10
-
Gene/Insert nameADH1 terminator (S. stipitis)
-
SpeciesS. stipitis
-
Insert Size (bp)241
Cloning Information for Gene/Insert 10
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer ctgcagccaatctgaaga
- 3′ sequencing primer CAGAGAAGAATGCATGCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCaCas9 that is in this plasmid was originally synthesized, cloned and published by Vyas VK, Barrasa MI, Fink GR. 2015. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families. Science advances. 1:e1500248.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWR63 was a gift from J. Brian Robertson (Addgene plasmid # 203331 ; http://n2t.net/addgene:203331 ; RRID:Addgene_203331) -
For your References section:
BLINCAR: a reusable bioluminescent and Cas9-based genetic toolset for repeatedly modifying wild-type Scheffersomyces stipitis. Reichard WD, Smith SE, Robertson JB. mSphere. 2023 Aug 24;8(4):e0022423. doi: 10.1128/msphere.00224-23. Epub 2023 Jun 22. 10.1128/msphere.00224-23 PubMed 37345937