pAG426GAL-FES
(Plasmid
#203501)
-
PurposeExpresses human FES kinase from a GAL promoter with a URA3 marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAG426GAL-ccdB
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFES
-
SpeciesH. sapiens (human)
-
Entrez GeneFES (a.k.a. FPS)
- Promoter GAL1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAATGTAATAAAAGTATCAACAAAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG426GAL-FES was a gift from Alejandro Chavez (Addgene plasmid # 203501 ; http://n2t.net/addgene:203501 ; RRID:Addgene_203501) -
For your References section:
A multiplex method for rapidly identifying viral protease inhibitors. Hong SJ, Resnick SJ, Iketani S, Cha JW, Albert BA, Fazekas CT, Chang CW, Liu H, Dagan S, Abagyan MR, Fajtova P, Culbertson B, Brace B, Reddem ER, Forouhar F, Glickman JF, Balkovec JM, Stockwell BR, Shapiro L, O'Donoghue AJ, Sabo Y, Freundlich JS, Ho DD, Chavez A. Mol Syst Biol. 2025 Feb;21(2):158-172. doi: 10.1038/s44320-024-00082-1. Epub 2025 Jan 6. 10.1038/s44320-024-00082-1 PubMed 39762652