pQFT-mNGsacB
(Plasmid
#203676)
-
PurposepQFT with mNeonGreen and sacB under control of PQJ
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepQFT
-
Backbone manufacturerAndreas Kaczmarczyk
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 9500
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemNeonGreen
-
Alt namemNG
-
SpeciesSynthetic
-
Insert Size (bp)700
- Promoter PQJ
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer 10572 (TACATATGTCAATGTACCGG)
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesacB
-
SpeciesBacillus subtilis
-
Insert Size (bp)1400
-
MutationHas synonymous (silent) mutations to remove BsrGI and HpaI restriction sites
- Promoter PQJ
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 18048 (AAATCAGCCGATGTATGTGTTCCG)
- 3′ sequencing primer M13
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQFT-mNGsacB was a gift from Urs Jenal (Addgene plasmid # 203676 ; http://n2t.net/addgene:203676 ; RRID:Addgene_203676) -
For your References section:
A Synthetic Cumate-Inducible Promoter for Graded and Homogenous Gene Expression in Pseudomonas aeruginosa. Klotz A, Kaczmarczyk A, Jenal U. Appl Environ Microbiol. 2023 May 18:e0021123. doi: 10.1128/aem.00211-23. 10.1128/aem.00211-23 PubMed 37199671