pMRMTK-clo5
(Plasmid
#203956)
-
PurposeCloning plasmid containing the chloramphenicol resistance gene insert
-
Depositing Lab
-
Depositing OrganizationNorth Carolina State University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneR6Kγ origin of replication and oriT
- Backbone size w/o insert (bp) 789
- Total vector size (bp) 1615
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameChloramphenicol Resistance Gene
-
Insert Size (bp)826
- Promoter CAT promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (not destroyed)
- 3′ cloning site BsaI (not destroyed)
- 5′ sequencing primer TCCTTAGCTCCTGAAAATCTCGATAACTC
- 3′ sequencing primer CCTGCCACTCATCGCAGTACTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.05.543168v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRMTK-clo5 was a gift from Nathan Crook (Addgene plasmid # 203956 ; http://n2t.net/addgene:203956 ; RRID:Addgene_203956) -
For your References section:
Engineering the Maize Root Microbiome: A Rapid MoClo Toolkit and Identification of Potential Bacterial Chassis for Studying Plant-Microbe Interactions. van Schaik J, Li Z, Cheadle J, Crook N. ACS Synth Biol. 2023 Oct 20;12(10):3030-3040. doi: 10.1021/acssynbio.3c00371. Epub 2023 Sep 15. 10.1021/acssynbio.3c00371 PubMed 37712562