Skip to main content
Addgene
Open Menu

pTY152 EGFP-T2A-ORF6 SARS-CoV-1
(Plasmid #204974)

Print

Ordering

This material is available to academics and nonprofits only. Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 204974 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 204974-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 204974-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pSectag2
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 5885
  • Modifications to backbone
    EGFP-T2A inserted at the N-terminus of ORF6
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Open Reading Frame 6
  • Species
    SARS-CoV-1
  • Insert Size (bp)
    192
  • Entrez Gene
    ORF6 (a.k.a. sars6)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTY152 EGFP-T2A-ORF6 SARS-CoV-1 was a gift from Tim Mitchison (Addgene plasmid # 204974 ; http://n2t.net/addgene:204974 ; RRID:Addgene_204974)

  • For your References section:

    Quantitative comparison of nuclear transport inhibition by SARS coronavirus ORF6 reveals the importance of oligomerization. Yoo TY, Mitchison TJ. Proc Natl Acad Sci U S A. 2024 Jan 23;121(4):e2307997121. doi: 10.1073/pnas.2307997121. Epub 2024 Jan 18. 10.1073/pnas.2307997121 PubMed 38236733
Related items: