pAG1186 Lyn11-ECFP-FIREmate
(Plasmid
#205168)
-
PurposeExpresses Lyn11-ECFP-FIREmate in mammalian cells
-
Depositing Lab
-
Depositing OrganizationSorbonne Université
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 205168-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 205168-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 4005
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLyn11-ECFP-FIREmate
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 205168-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 205168-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG1186 Lyn11-ECFP-FIREmate was a gift from Arnaud Gautier (Addgene plasmid # 205168 ; http://n2t.net/addgene:205168 ; RRID:Addgene_205168) -
For your References section:
A fluorogenic chemically induced dimerization technology for controlling, imaging and sensing protein proximity. Bottone S, Joliot O, Cakil ZV, El Hajji L, Rakotoarison LM, Boncompain G, Perez F, Gautier A. Nat Methods. 2023 Aug 28. doi: 10.1038/s41592-023-01988-8. 10.1038/s41592-023-01988-8 PubMed 37640938