hSTX4(1-271,272C)
(Plasmid
#206031)
-
PurposeBacterial expression of human Syntaxin 4 without transmembrane helix and a C-terminal cysteine
-
Depositing Lab
-
Depositing OrganizationUniversity of Groningen
Located in the Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET28a(+)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSyntaxin-4
-
Alt nameSTX4
-
SpeciesH. sapiens (human)
-
Mutationdeleted amino acids 272-297 (encoding the transmembrane domain), added a C-terminal cysteine
-
GenBank IDNM_001272096.1
-
Entrez GeneSTX4 (a.k.a. STX4A, p35-2)
- Promoter T7
-
Tag
/ Fusion Protein
- his-tag (removable with thrombin) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic gene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hSTX4(1-271,272C) was a gift from Geert van den Bogaart (Addgene plasmid # 206031 ; http://n2t.net/addgene:206031 ; RRID:Addgene_206031) -
For your References section:
Phosphorylation of VAMP3 couples IL-6 Exocytosis to dendritic cell activation. Chen T, Psoma A, Mahajan S, Ter Beest M, Linders P, Franciosa G, Bianchi F, Bogaart GVD, Warner H. J Cell Sci. 2025 Sep 22:jcs.264139. doi: 10.1242/jcs.264139. 10.1242/jcs.264139 PubMed 40977280