cacna2d1 BBS pMT2
(Plasmid
#206062)
-
Purposeexpression of rat calcium channel alpha2delta-1 with a single Bungarotoxin Binding Site motif inserted after aa549
-
Depositing Lab
-
Depositing OrganizationUniversity College London
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206062 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMT2
-
Backbone manufacturerGenetics Institute Inc
- Backbone size w/o insert (bp) 5163
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna2d1
-
Alt namealpha2delta-1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3794
-
Entrez GeneCacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
- Promoter Ad MLP/TPL/SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
- 3′ sequencing primer GGTCGAACCATGATGGCAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKevin Campbell
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacna2d1 BBS pMT2 was a gift from Annette Dolphin (Addgene plasmid # 206062 ; http://n2t.net/addgene:206062 ; RRID:Addgene_206062) -
For your References section:
Rab11-dependent recycling of calcium channels is mediated by auxiliary subunit alpha(2)delta-1 but not alpha(2)delta-3. Meyer JO, Dolphin AC. Sci Rep. 2021 May 13;11(1):10256. doi: 10.1038/s41598-021-89820-1. 10.1038/s41598-021-89820-1 PubMed 33986433