Bn CAAX pcDNA3
(Plasmid
#206088)
-
PurposeCav2.2 N-terminus (amino acids 1-95) with a C-terminal tag of the final 10 aa of H.Ras containing CAAX motif
-
Depositing Lab
-
Depositing OrganizationUniversity College London
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen Life Technologies
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna1b
-
Alt nameCav2.2 alpha1B
-
SpeciesO. cuniculus (rabbit)
-
Entrez GeneCACNA1B
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTGGCTAACTAGAGAACC
- 3′ sequencing primer GCATTTAGGTGACACTATAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYasuo Mori
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' end of Cav2.2 DNA is very GC rich
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Bn CAAX pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206088 ; http://n2t.net/addgene:206088 ; RRID:Addgene_206088) -
For your References section:
N terminus is key to the dominant negative suppression of Ca(V)2 calcium channels: implications for episodic ataxia type 2. Page KM, Heblich F, Margas W, Pratt WS, Nieto-Rostro M, Chaggar K, Sandhu K, Davies A, Dolphin AC. J Biol Chem. 2010 Jan 8;285(2):835-44. doi: 10.1074/jbc.M109.065045. Epub 2009 Nov 10. 10.1074/jbc.M109.065045 PubMed 19903821