Skip to main content

139H2_HC
(Plasmid #206201)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206201 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pRK5
  • Backbone size w/o insert (bp) 5014
  • Total vector size (bp) 6430
  • Modifications to backbone
    3' UTR altered, multiple cloning site altered
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    anti-MUC1 antibody 139H2 heavy chain
  • Alt name
    139H2_HC
  • Alt name
    IgG1 heavy chain
  • Alt name
    IGHG1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1416
  • GenBank ID
    16017
  • Entrez Gene
    Ighg1 (a.k.a. IgG1, Igh-4, VH7183)
  • Promoter CMV
  • Tag / Fusion Protein
    • -AAAHHHHHHHH (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GAAGAGGAAGAAAGGGAAAC
  • 3′ sequencing primer CTGTAATTGACAGCCTTGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    139H2_HC was a gift from Joost Snijder (Addgene plasmid # 206201 ; http://n2t.net/addgene:206201 ; RRID:Addgene_206201)
  • For your References section:

    Reverse-engineering the anti-MUC1 antibody 139H2 by mass spectrometry-based de novo sequencing. Peng W, Giesbers KC, Siborova M, Beugelink JW, Pronker MF, Schulte D, Hilkens J, Janssen BJ, Strijbis K, Snijder J. Life Sci Alliance. 2024 Mar 20;7(6):e202302366. doi: 10.26508/lsa.202302366. Print 2024 Jun. 10.26508/lsa.202302366 PubMed 38508723