Skip to main content

RNF168-Halo HRD
(Plasmid #207080)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207080 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 207080-D50 50 μg of DNA in Tris buffer $495
DNA 207080-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pFastBac dual
  • Backbone size w/o insert (bp) 4999
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
  • Species
    H. sapiens (human), Synthetic
  • Promoter None

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTTTAAAAAACCTCCCACACCTC
  • 3′ sequencing primer AAA CCA CAA CTA GAA TGC AGT GA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RNF168-Halo HRD was a gift from Jens Schmidt (Addgene plasmid # 207080 ; http://n2t.net/addgene:207080 ; RRID:Addgene_207080)
  • For your References section:

    Systematic analysis of the molecular and biophysical properties of key DNA damage response factors. Heyza JR, Mikhova M, Bahl A, Broadbent DG, Schmidt JC. Elife. 2023 Jun 21;12:e87086. doi: 10.7554/eLife.87086. 10.7554/eLife.87086 PubMed 37341699