Skip to main content

Halo-TCAB1 KI sgRNA
(Plasmid #207611)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207611 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 207611-D50 50 μg of DNA in Tris buffer $495
DNA 207611-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pX330 Addgene #42230
  • Total vector size (bp) 8500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CCAAAGTCTTCATACTGCAG
  • Species
    H. sapiens (human)
  • Promoter CMV and U6
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer U6 forward
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Halo-TCAB1 KI sgRNA was a gift from Jens Schmidt (Addgene plasmid # 207611 ; http://n2t.net/addgene:207611 ; RRID:Addgene_207611)
  • For your References section:

    TCAB1 prevents nucleolar accumulation of the telomerase RNA to facilitate telomerase assembly. Klump BM, Perez GI, Patrick EM, Adams-Boone K, Cohen SB, Han L, Yu K, Schmidt JC. Cell Rep. 2023 Jun 1;42(6):112577. doi: 10.1016/j.celrep.2023.112577. 10.1016/j.celrep.2023.112577 PubMed 37267110