Halo-TCAB1 KI sgRNA
(Plasmid
#207611)
-
PurposesgRNA for HaloTag insertion into the endogenous TCAB1 locus
-
Depositing Lab
-
Depositing OrganizationMichigan State University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330 Addgene #42230
- Total vector size (bp) 8500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCAAAGTCTTCATACTGCAG
-
SpeciesH. sapiens (human)
- Promoter CMV and U6
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer U6 forward
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-TCAB1 KI sgRNA was a gift from Jens Schmidt (Addgene plasmid # 207611 ; http://n2t.net/addgene:207611 ; RRID:Addgene_207611) -
For your References section:
TCAB1 prevents nucleolar accumulation of the telomerase RNA to facilitate telomerase assembly. Klump BM, Perez GI, Patrick EM, Adams-Boone K, Cohen SB, Han L, Yu K, Schmidt JC. Cell Rep. 2023 Jun 1;42(6):112577. doi: 10.1016/j.celrep.2023.112577. 10.1016/j.celrep.2023.112577 PubMed 37267110