pAf-CRISPR-phoA
(Plasmid
#207991)
-
PurposeCRISPR vector used with pAf-CRISPR-ctfR1 (#207992) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavus
-
Depositing Lab
-
Depositing OrganizationUSDA ARS New Orleans, Southern Regional Research Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 207991-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 207991-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepPTRII
-
Backbone manufacturerTaKaRa
- Backbone size w/o insert (bp) 10031
- Total vector size (bp) 13733
-
Modifications to backboneRemoval of non-functional sequence of AMA1 in pPTRII, expression of cas9 using Aspergillus nidulans gpdA promoter and trpC terminator, expression of sgRNA using Aspergillus flavus U6 promoter and terminator
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namephoA
-
gRNA/shRNA sequenceGTCATCCTTAGACGACACTC
-
SpeciesAspergillus flavus
- Promoter Aspergillus flavus U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ATACTGCAGTTCTCTTTAGAATTCAACTGTGGGT
- 3′ sequencing primer TATGGTACCACATATTTAAAAAAAGTCTCCTGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 207991-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 207991-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAf-CRISPR-phoA was a gift from Perng-Kuang Chang (Addgene plasmid # 207991 ; http://n2t.net/addgene:207991 ; RRID:Addgene_207991) -
For your References section:
Creating large chromosomal segment deletions in Aspergillus flavus by a dual CRISPR/Cas9 system: Deletion of gene clusters for production of aflatoxin, cyclopiazonic acid, and ustiloxin B. Chang PK. Fungal Genet Biol. 2023 Dec 27;170:103863. doi: 10.1016/j.fgb.2023.103863. 10.1016/j.fgb.2023.103863 PubMed 38154756