Skip to main content

phROSA26-Tet-HA-JLP_WT
(Plasmid #208770)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208770 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 208770-D50 50 μg of DNA in Tris buffer $495
DNA 208770-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMK365
  • Backbone manufacturer
    Addgene #121185
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    JLP
  • Alt name
    JIP4
  • Alt name
    SPAG9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3996
  • Entrez Gene
    SPAG9 (a.k.a. CT89, HLC-6, HLC4, HLC6, JIP-4, JIP4, JLP, PHET, PIG6)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CTTTGCTTATGTAAACCAGG
  • 3′ sequencing primer attaagggttattgaatatgatcgCCCCGAAAAGTGCCACCTGACGTCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phROSA26-Tet-HA-JLP_WT was a gift from Katsuji Yoshioka (Addgene plasmid # 208770 ; http://n2t.net/addgene:208770 ; RRID:Addgene_208770)
  • For your References section:

    Overexpression of JNK-associated leucine zipper protein induces chromosomal instability through interaction with dynein light intermediate chain 1. Suzuki R, Kanemaki MT, Suzuki T, Yoshioka K. Genes Cells. 2023 Nov 14. doi: 10.1111/gtc.13083. 10.1111/gtc.13083 PubMed 37963657